Step 3: Aligning reads
Most analyses of short-read sequence data are based on the basic paradigm made up of two steps:
- first, align reads to an established reference genome assembly.
- then use those alignments to identify and call genetic variation for analysis.
The first step in this paradigm is to get reads aligned. On this page we'll implement the basic read alignment pipeline that starts with the fastqs and ends with alignments for downstream analysis.
The basic pipeline
The basic pipeline is:
- align reads to the reference genome assembly
- sort them so they are in genome position order
- 'mark' reads that look like duplicates (since these are likely to be artifacts.)
- Finally we'll gather some statistics about the alignments.
In theory that's it - in practice it gets a bit more fiddly because of the need for various format conversion and indexing steps. (Some data might also need a read trimming step but we're skipping that.)
Without further ado let's implement these steps using a popular aligner bwa mem
and the swiss
army knife-like samtools
to do the work. As before I'll work with the data for the QG0033-C
malaria sample (which was ascertained in Congo in 2012), but if you know what you are doing you are
free to work with any of the other samples in the folder - or the chromosome 19 human data in the
human/
folder if you prefer. (Just remember to use the human reference sequence GRCh38_chr19.fa
in that case.)
To get started, move to a terminal window and make sure you are in the
sequence_data_analysis/malaria
folder:
cd ~/sequence_data_analysis/malaria
The pipeline can be run like this:
# Make a temp dir to hold intermediate files
mkdir -p tmp
# Create a FM index for the reference
bwa index Pf3D7_v3.fa
# align the reads (using 2 threads - don't use more please!)
bwa mem -t 4 -o tmp/QG0033-C-aligned.sam Pf3D7_v3.fa QG0033-C_Illumina-HiSeq_read1.fastq.gz QG0033-C_Illumina-HiSeq_read2.fastq.gz
# convert to BAM
samtools view -b -o tmp/QG0033-C-aligned.bam tmp/QG0033-C-aligned.sam
# fix mate-pair information and convert to BAM
samtools fixmate -m tmp/QG0033-C-aligned.bam tmp/QG0033-C-fixmate.bam
# sort reads by genomic position
samtools sort -T tmp -o tmp/QG0033-C-sorted.bam tmp/QG0033-C-fixmate.bam
# Identify probable duplicate reads
samtools markdup -s tmp/QG0033-C-sorted.bam tmp/QG0033-C-markdup.bam
# Rename to this folder, and index
mv tmp/QG0033-C-markdup.bam QG0033-C.bam
samtools index QG0033-C.bam
(Note. You can see what this has created by running ls
.)
If you run all that together it might take around 10 minutes to complete (the longest steps being the bwa mem
indexing and alignment steps.) It's worth running the steps one by one to make sure they complete without errors, and
watching the output to see what is being done. While you're waiting for the alignment to complete, consider reading the
information below about what's in the aligned data, reading more about paired-end sequencing theory,
or more about the SAM/BAM format and using samtools.
For example here is a useful overview of SAM format, or a page with more tips on using samtools.
What did the pipeline generate?
If you followed the above you'll now have:
a file
tmp/QG0033-C-aligned.sam
which contains the alignments in the SAM text file format.a binary version
tmp/QG0033-C-aligned.bam
of the same thing, in BAM format.a coordinate-sorted version of that, in
tmp/QG0033-C-sorted.bam
a final version of the alignments with duplicate reads 'marked' - called
QG0033-C.bam
and a corresponding index file
QG0033-C.bam.bai
.
Congratulations! You should now have an aligned set of reads ready for analysis.
The rest of this page gives details about what is in the alignment files you've just created. When you're satisfied you know enough, go back to the practical.
Inspecting the alignment output
The contents of a SAM file
If you look at the unsorted SAM file (e.g. by typing less -S tmp/QG0033-C-aligned.sam
- press q
when you want to quit) you'll see something like this:
@SQ SN:Pf3D7_08_v3 LN:1472805
@SQ SN:Pf_M76611 LN:5967
@SQ SN:Pf3D7_01_v3 LN:640851
@SQ SN:Pf3D7_09_v3 LN:1541735
@SQ SN:Pf3D7_03_v3 LN:1067971
@SQ SN:Pf3D7_05_v3 LN:1343557
@SQ SN:Pf3D7_02_v3 LN:947102
@SQ SN:Pf3D7_14_v3 LN:3291936
@SQ SN:Pf3D7_11_v3 LN:2038340
@SQ SN:Pf3D7_10_v3 LN:1687656
@SQ SN:Pf3D7_04_v3 LN:1200490
@SQ SN:Pf3D7_12_v3 LN:2271494
@SQ SN:Pf3D7_13_v3 LN:2925236
@SQ SN:Pf3D7_06_v3 LN:1418242
@SQ SN:Pf3D7_07_v3 LN:1445207
@SQ SN:PF_apicoplast_genome_1 LN:29430
@PG ID:bwa PN:bwa VN:0.7.17-r1188 CL:bwa mem -t 2 -o QG0033-C-aligned.sam Pf3D7_v3.fa QG0033-C_Illumina-HiSeq_read1.fast
ERR377582.7615542 99 Pf3D7_09_v3 37181 21 100M = 37244 163 AAAAATCCATTTATATCTTTTATGGTTAGTATTATTTATACCTTCCTGTTTTATTTATCCACGTTTTATAAAATTGACGTATTGTTAATAAGTAGTTGTA B@DECEFEEGFEEHFGGEFFFFFEFFEEFEGHHGGGFFFAEFFFGGEFFHFGEEFFEDEGDDEF@GFGEGEEGHEEDGGGEFEEFFEEEDEFDGDECEEF NM:i:1 MD:Z:58T41 MC:Z:100M AS:i:95 XS:i:91
ERR377582.7615542 147 Pf3D7_09_v3 37244 21 100M = 37181 -163 TTTTATAAAATTGACGTATTGTTAATAAGTAGTTGTATATTATAAATTATAAGGTAATATAATTGCTATAATTATAATAATCATTATCATAATTATTATC DHEDGBHEDGFEDAAGEDEDGFHGGGDEFCFGFGFFEEEIBCFCIFDEEDFFGGBEFDGEEGEFFEFHIFDEFEHHEFHEDDFFEEFDFEEFDEDECA@9 NM:i:2 MD:Z:43G49A6 MC:Z:100M AS:i:90 XS:i:90
ERR377582.19970658 77 * 0 0 * * 0 0 TGATCGGTGCGGGCCGGACTGAATTGCTACGCCTGATTTTCGGTGCCGACCTGGCCGACAGTGGCACGGTGGCCTTGGGGTCGCCAGCGCAGGTGGTGAG *:?D<CF3-D@EE@EDDGFF?DDEFACEFEBHCGD/EFEE:?E;F?GE=2FE>FFC:EHD??H@DFFB89CD@D-ECC8;EF.A:;6EEDDFA,D>'D@F AS:i:0 XS:i:0
...
The file consists of some metadata (lines starting with @
, and recording information about the sequences in the reference
assembly and the program that was run to generate the alignments) followed by the alignments themselves.
The alignment columns rows consist of
- The read ID (straight from the fastq file)
- Some flags encoded as an integer. The best way to understand these is through the "Explain SAM flags" webpage. We'll go through some examples below.
- The chromosome and position at which the read aligns
- The mapping quality, detailed more below.
- The CIGAR string which gives some detail about how the read aligns
- The chromosome and position of the other read in the pair if it's aligned. (The
chromosome is often
=
, which means the same chromosome as this read, which you'd expect since they both came from the same fragment. A*
means the other read was not aligned). - The 'template length' (how long was the span of the read pair on the reference contig?)
- The read bases and mapping qualities. These are straight from the fastq but reverse-complemented if necessary so they are in the same order as the reference bases.
- Finally there are some optional fields. Among these are NM (number of mismatches between the read and the reference), and MD (a kind of counterpoint to the CIGAR string in column 6).
If you look at the read IDs and flags above (via this page), you'll see that the read pairs are represented as pairs of alignments with the same identifiers but with one flagged as 'first in pair' and the other as 'second in pair'.
How many alignments are there?
We can use the UNIX wc
command to count the alignments:
samtools view tmp/QG0033-C-aligned.sam | wc -l
Note. The BAM file is exactly the same, it's just encoded in a binary format. So this also works and is slightly quicker:
samtools view tmp/QG0033-C-aligned.bam | wc -l
If you run this with the above data it says there are 4,057,972 alignments. But wait - there were only 2 million read pairs!
This illustrates an important point: there are more alignments than reads in the data. How can this be?
Primary and supplementary alignments
To figure out why, let's look at an example: the read with ID ERR377582.20226793
. You can extract
this using grep
like this:
grep 'ERR377582.20226793' tmp/QG0033-C-aligned.sam
If you look at the alignment flags (second columns) via this page, you'll see that:
- The first alignment (flag=81) represents the first read in the pair. It is aligned on the reverse strand of the reference.
- The second alignment (flag=2113) also represents the first read in the pair. It is flagged as a supplementary alignment.
- The third alignment (flag=161) represents the second read in the pair.
Terminology: A supplementary alignment occurs when a read aligns in more than one part. (The additional alignments aren't adjacent to the primary one, otherwise they would be part of it.)
You can see how this works for this read by looking at the CIGAR string. For the first alignment
the CIGAR is 60M40S
. This means that the first 60 bases of the 100bp read were aligned, and the
following 40 were 'soft clipped' - not part of the alignment. For the supplementary alignment, the
CIGAR is 54M46H
. If you look at the read bases you will see they are the reverse complement of
the bases from the original read (which are fully represented in the first alignment). The upshot
is that bwa
thinks the first ~60 bases align to chromosome Pf3D7_10_v3
, but the last ~54 bases
align in reverse orientation to chromosome Pf3D7_09_v3
.
Interpreting mapping qualities
Taken at face value you might think that this means this sample has a translocation between chromosome 9 and 10. But hold on. If you look at the mapping quality column (column 5) you'll see that all these alignments actually have zero mapping quality. This means that confidence in these alignments is very low!
Like base qualities, mapping qualities are expressed on the PHRED scale. They are the aligner's estimate of the quantity: the probability that the read actually aligns elsewhere. On the PHRED scale this is expressed as:
which gives this relationship:
mapping quality | Estimated probability alignment is wrong |
---|---|
0 | 100% |
10 | 10% |
20 | 1% |
30 | 0.1% |
40 | 0.001% |
A mapping quality of zero translates to a 100% probability that the read aligns elsewhere, that is,
that bwa
is not confident at all in this alignment.
Note. Also like base qualities, this is only an estimate of the probability. It may not be well calibrated.
(What's really going on is that these reads original from the telomeres. Telomeres in malaria, as in humans and other organisms, are highly repetitive and are very hard to analyse using short-read data.)
What types of alignment are there?
To get a better sense of the types of alignment let's use samtools flagstat
.
This counts reads according to the flags
column. Run it like this:
samtools flagstat tmp/QG0033-C-aligned.sam
From the output you should see:
- Of 4 million reads ("4000000 paired in sequencing"), only 3,804,730 were actually aligned by
bwa
. That's nearly 200,000 that weren't aligned at all. - Most of these (3731534) were were aligned in pairs.
- Most of these (3537816) were 'properly paired' - that is, both reads mapped to the same chromosome, in the right orientation (i.e. facing each other) and about the right distance apart.
- But a small subset (264863 in total) had unmapped mate, mate on a different chromosome, or not close or in the wrong orientation to the original read.
Note. A much more detailed view of reads can be generated by running samtools stats
. See more
on the samtools stats
documentation page.
What did markdup
do?
Question what did the samtools markdup
step do?
Hint 1. Try viewing the first reads in the coordinate-sorted and final (post-markdup BAM). E.g.:
samtools view tmp/QG0033-C-sorted.bam | head
samtools view QG0033-C.bam | head
Can you spot the difference
Hint. Try running samtools flagstat
on these two files. What's different?
Important! Cleaning up
Our pipeline has left behind several copies of the original data that we don't need. See them by looking in the temp directory:
ls -lh tmp
du -ch tmp
That's 2.4Gb of space essentially wasted! Now is a good time to get rid of these:
rm tmp/*
rmdir tmp
Note. Don't delete the main output file QG0033-C.bam
or its index - we'll look at that in a moment.
Next steps
Now that we have an aligned set of reads, move on to viewing your alignments.